View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4123_high_11 (Length: 235)
Name: NF4123_high_11
Description: NF4123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4123_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 7 - 155
Target Start/End: Complemental strand, 45035648 - 45035497
Alignment:
| Q |
7 |
ctacatacagtgcttatt-agcggggacatcgatttttgtattctttggatattttttcttgtatggtaatcaatagcaggtagctttctgtagt--tgt |
103 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45035648 |
ctacatacagtgcttatttagtggggacatcgatttttgtattctttggatattttttcttgtatggtaatcaatagcaggtagctttctgtagttctgt |
45035549 |
T |
 |
| Q |
104 |
ctctatatgttgtaaaaattctcactttttgtattttactagcattattacg |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45035548 |
ctctatatgttgtaaaaattctcactttttgtattttactagcattattacg |
45035497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 23 - 155
Target Start/End: Complemental strand, 45041505 - 45041371
Alignment:
| Q |
23 |
ttagcggggacatcgatttttgtattctttggatattttttcttgtatggtaatcaatagcaggtagctttctgtagt--tgtctctatatgttgtaaaa |
120 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
45041505 |
ttagtggggacatggatttttgtattctttggatattttttcttgtatggtaatcaatagcaggtagctttctgttgttctgtctttatatgttgtaaaa |
45041406 |
T |
 |
| Q |
121 |
attctcactttttgtattttactagcattattacg |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45041405 |
attctcactttttgtattttactagcattattacg |
45041371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University