View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4123_high_4 (Length: 414)
Name: NF4123_high_4
Description: NF4123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4123_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 9e-77; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 121 - 270
Target Start/End: Original strand, 51690397 - 51690546
Alignment:
| Q |
121 |
cagagtaggaagacagcagaagaggggatatatagaaggtaatattaattgatggaatgaagacatgtttcctattgtggggtcaagttcaatatgtggc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51690397 |
cagagtaggaagacagcagaagaggggatatatagaaggtaatattaattgatggaatgaagacatgtttcctattgtggggtcaagttcaatatgtggc |
51690496 |
T |
|
| Q |
221 |
atacaaaaattatttaacagaaaaaggtttcctttcattttgtttgtgag |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51690497 |
atacaaaaattatttaacagaaaaaggtttcctttcatattgtttgtgag |
51690546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 327 - 398
Target Start/End: Original strand, 51690603 - 51690674
Alignment:
| Q |
327 |
tggagacgcatggattattttgaaatacaaaaactcttttaggagtaaaaaacatgttttgtgcgagggata |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51690603 |
tggagacgcatggattattttgaaatacaataactcttttaggagtgaaaaacatgttttgtgcgagggata |
51690674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 17 - 47
Target Start/End: Original strand, 51690293 - 51690323
Alignment:
| Q |
17 |
tgtgccctgaaaatttataacaaaccaccca |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
51690293 |
tgtgccctgaaaatttataacaaaccaccca |
51690323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University