View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4123_high_8 (Length: 304)
Name: NF4123_high_8
Description: NF4123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4123_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 42456786 - 42456501
Alignment:
| Q |
1 |
ggttgttgacaataacgtagaagggggtgttgttggtaataatccaggaaattcttgttgaacatattggattgggcctactagaatggacaaggtaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42456786 |
ggttgttgacaataacgtagaagggggtgttgttggtaataatccaggaaattcttgttgaacatattggattgggcctactagaatggacaaggtaaaa |
42456687 |
T |
|
| Q |
101 |
gaacttacaatattagggaaattgctctttgggcgccatggtttgatctcaagcaccctgaatgaaccattttattcctaatggtagttatctattgctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42456686 |
gaacttacaatattagggaaattgctctttgggcgccatggtttgatctcaagcaccctgaatgaaccattttattcctaatggtagtcatctattgctc |
42456587 |
T |
|
| Q |
201 |
acatgattatagtaattaaatttcattctcatatacgacacttaactgtcgtatcagatgtgttgatatattagatagcttacttgt |
287 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42456586 |
acatgattatagt-atgaaatttcattctcatatacgacacttaactgtcgtatcagatgtgttgatatattagatagcttacttgt |
42456501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University