View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4123_low_19 (Length: 238)
Name: NF4123_low_19
Description: NF4123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4123_low_19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 238
Target Start/End: Complemental strand, 38564728 - 38564504
Alignment:
| Q |
14 |
atcattgacttgcgtagaacgcataatatgcatgcaccgcggcttcaaattcatcatatgataataaaactttgcacaatcatttaaaagattaagtttt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38564728 |
atcattgacttgcgtagaacgcataatatgcatgcaccgcggcttcaaactcatcatatgataataaaaccttgcacaatcatttaaaagattaagtttt |
38564629 |
T |
 |
| Q |
114 |
gctatatatgactctagctagccactattgaattttaagatgagaacacagaggaggtgatagtggtttacgtgcatgtctcattacccttttcttatgc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38564628 |
gctatatatgactctagctagccactattgaattttaagatgagaacacagaggaggggatagtggtttacgtgcaagtctcattacccttttcttatgc |
38564529 |
T |
 |
| Q |
214 |
caggatatatcgagaaattaaaatt |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38564528 |
caggatatatcgagaaattaaaatt |
38564504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University