View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4124_high_20 (Length: 263)
Name: NF4124_high_20
Description: NF4124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4124_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 248
Target Start/End: Complemental strand, 12221758 - 12221527
Alignment:
| Q |
17 |
agtttttgatgtcttcattttggatcctcaaaacatcatgtatgtatgatttcccatgattttctgctgaaagtaatccgttgtagaaatctgctacacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
12221758 |
agtttttgatgtcttcattttggatcatcaaaacatcatgtatgtatgatttcccatgattttctggtgaaagtaatccattgtagaaatctgctacacc |
12221659 |
T |
 |
| Q |
117 |
aattgttttgaacagtgctggtgtttctggagttacaagagatgatattggacttatatttccaatccattctgggccgtaaaatgctgctatggatagc |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12221658 |
aattgttttgaacaatgctggtgtttctggagttacaagagatgatattggacttatatttccaatccattctgggccgtaaaatgctgctatggatagc |
12221559 |
T |
 |
| Q |
217 |
ctctctttttgtgagtttactatagctctgtg |
248 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
12221558 |
ctctctttttctgagtttactatagctctgtg |
12221527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University