View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4124_high_23 (Length: 237)
Name: NF4124_high_23
Description: NF4124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4124_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 5005435 - 5005302
Alignment:
| Q |
1 |
atcatccaaatacaggtgaggagagcgatagtacagtcgagtgagagttggctgattctttctcaagtatactaaagagtacgaaagtcttgaaaacatc |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5005435 |
atcatccaaacacaggtgaggagagcgatagtacagtcgagtgagagttggctgattctttctcaagtatactaaagagtacgaaagtcttgaaaacatc |
5005336 |
T |
|
| Q |
101 |
atacttagccaaagtgcaatagaattggacaata |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5005335 |
atacttagccaaagtgcaatagaattggacaata |
5005302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 133 - 224
Target Start/End: Complemental strand, 5005021 - 5004929
Alignment:
| Q |
133 |
tatgacattcaactcgtgccttttg-attttagcatcaccaactgaaataagcaattaacataacataaagacacatttccacggagattgtg |
224 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5005021 |
tatgacattcaactcgtgctttttttattttagcttcaccaactgaaataagcaattaacataacataaagacacatttccacggagattgtg |
5004929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University