View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4124_low_20 (Length: 346)
Name: NF4124_low_20
Description: NF4124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4124_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 242 - 329
Target Start/End: Complemental strand, 5812774 - 5812687
Alignment:
| Q |
242 |
gaagtatttagaacaattatgaaagtaactacaatattagcgccgtggttcttcctctcacgtttgcgtgcttgttctacatcgtcct |
329 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5812774 |
gaagtatttagaacaattctgaaagtaactacgatattagcgccgtggttcttcctctcacgtttgcgtacttgttctacatcgtcct |
5812687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 17 - 45
Target Start/End: Complemental strand, 5813001 - 5812973
Alignment:
| Q |
17 |
tatatttagttgagatatttatgctacat |
45 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5813001 |
tatatttagttgagatatttatgctacat |
5812973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University