View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4124_low_22 (Length: 298)
Name: NF4124_low_22
Description: NF4124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4124_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 288
Target Start/End: Complemental strand, 43921154 - 43920884
Alignment:
| Q |
18 |
ataaatgcaactagtagtttctttgatctacacagtaagtactctctttcattttacaaatttcatcattttctgcaacttctacaaaatatttttcaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43921154 |
ataaatgcaactagtagtttctttgatctacacagtaagtactctctttcattttacaaatttcatcattttctgcaacttctacaaaatattttgcaac |
43921055 |
T |
|
| Q |
118 |
ttattagtatgtcaagaccggggaataagatcattcaagccaagctggtaggtatgtcttaccttattactaaattttgtttttgtgttccagataccag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43921054 |
ttattagtatgtcaagaccggggaataagatcattcaagccaagctggtaggtatgtcttaccttattactaaattttgtttttttgttccagataccag |
43920955 |
T |
|
| Q |
218 |
tcannnnnnnatgaatatgtacttgatcttcttctatcaagttattattatgttaaaaaatcctacctatg |
288 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43920954 |
tcatttttttatgaatatgtacttgatcttcttctatcaagttattattatgttaaaaaatcctacctatg |
43920884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University