View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4124_low_27 (Length: 238)
Name: NF4124_low_27
Description: NF4124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4124_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 33191971 - 33191776
Alignment:
| Q |
16 |
atactttcaggttcaaattcttcttcgaagtagtgaatttttatccgaactaagttctcgagtattgtcaaataatgataacattaaccctataacacaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33191971 |
atactttcaggttcaaattcttcttcgaagtagtgaatttttatccgaactaagttctcgagtattgtcaaataatgataacattaaccctataacacaa |
33191872 |
T |
 |
| Q |
116 |
agatgtatattatttgaataacaattgtttggacatcttccgagacaatcaaagatacagacaaaaatgagaataggatttgatgttgtcaaagaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33191871 |
agatgtatattatttgaataacaattgtttggacatcttatgagacaatcaaagatacagacaaaaatgagaataggatttgatgttgtcaaagaa |
33191776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University