View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_high_41 (Length: 367)
Name: NF4125_high_41
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_high_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 125 - 324
Target Start/End: Complemental strand, 18605669 - 18605470
Alignment:
| Q |
125 |
ctatgaatacatataagaatctacattttaacccttgtttgaagattcttcatataaaataaattctaatttctcaatcctacaccgaaataaatggtaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18605669 |
ctatgaatacatataagaatctacattttaacccttgtttgaagattcttcgtataaaataaattcaaatttctcaatcctacaccgaaataaatggtaa |
18605570 |
T |
 |
| Q |
225 |
ttatatttattttttaagaatgtgaagatgtactagaacaatggaccttaatccatcatcttctttagtgctcttttgatagagtttgccgtttcacccc |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18605569 |
ttatatttattttttaagaatgtgaagatgtactagaacaatggaccttaatccatcatcttctttagttctcttttgatagagtttgccgtttcacccc |
18605470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 298 - 361
Target Start/End: Complemental strand, 18605459 - 18605396
Alignment:
| Q |
298 |
ttttgatagagtttgccgtttcacccctgtttcttgggaaacttcccatgaccgagcttgcttc |
361 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18605459 |
ttttgatagagtttgccatttcacccctgtttcttgggaaacttcccatgaccgagcttgcttc |
18605396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 12 - 53
Target Start/End: Complemental strand, 18605805 - 18605764
Alignment:
| Q |
12 |
taaagtcgcaaacagttaattaataaaacggttcaatggtaa |
53 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18605805 |
taaagtcacaaacagttaattaataaaacggttcaatggtaa |
18605764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University