View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_high_55 (Length: 314)
Name: NF4125_high_55
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_high_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 57 - 303
Target Start/End: Complemental strand, 37876091 - 37875845
Alignment:
| Q |
57 |
tatttctattagaccatttaataatagaccatgttggtttacggtgatttgatcacttctcttgcccatttcatattcatcacattgatgacttcgtatg |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37876091 |
tatttctattagaccatttaataatagaccatgttggtttacggtgatttgatcacttctctcgcccatttcatattcataacattgatgacttcgtatg |
37875992 |
T |
|
| Q |
157 |
gatgaatggacgagtttatcattgatcccaacttttgaaatactcctcttgttgatggcatattgtattttgtatatcagattctaagccacgacattgt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37875991 |
gatgaatggacgagtttatcattgatcccaacttttgaaatactcctcttgttgatggcatattgtattttgtatatcagattctaagccacgacattgt |
37875892 |
T |
|
| Q |
257 |
aataaatagtagcacacggagtttaacggacctgcgtgatgatgtcc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
37875891 |
aataaatagtagcacacggagtttaacggacctgcgtgttgaagtcc |
37875845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University