View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_high_64 (Length: 250)
Name: NF4125_high_64
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_high_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 4 - 202
Target Start/End: Complemental strand, 21153743 - 21153544
Alignment:
| Q |
4 |
gattcccttaaaaatcaagtaccaaattcctcaaacaaaactacatctacaaaataagtggtcttccacttcaaggatccttcgacaccgcacacaattc |
103 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21153743 |
gattcacttaaaaatcaagtatcaaattcctcaaacaaaactacatctacaaaataagtggtcttccacttcaaggatccttcgacaccgcacacaatcc |
21153644 |
T |
|
| Q |
104 |
gaattcacttcatacaaca-acactatctttctagataagttcccacgagtaggtaaacgattaagaattagttgacatgagaaaatttgcaccttttgt |
202 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21153643 |
gaattcacttcatacaacacacactatccttctaaataagttcccacgagtaggtaaactactaagaattagttgacatgagaaaatttgcaccttttgt |
21153544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University