View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_high_68 (Length: 238)
Name: NF4125_high_68
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_high_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 4389551 - 4389778
Alignment:
| Q |
1 |
tctgaattcccaataaaaggaaaatatattcttgggttagacttgtctacttgatgcagtccactgtaaaacattttagagtagtattggcaataaattt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389551 |
tctgaattcccaataaagggaaaatatattcttgggttagacttgtctacttgatgcagtccactgtaaaacattttagagtagtattggcaataaattt |
4389650 |
T |
|
| Q |
101 |
gcaaacgggaaatagaaaaaaggcgccggctaaaaataaaagtaaggttcatagggatttacaaaacaaaatagatgcacatgaggacattggtaaaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389651 |
gcaaacgggaaatagaaaaaaggcgccggctaaaaataaaagtaaggttcatagggatttacaaaacaaaatagatgcacatgaggacattggtaaaagc |
4389750 |
T |
|
| Q |
201 |
tttggtgtgttttcgcttcatgatgatg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4389751 |
tttggtgtgttttcgcttcatgatgatg |
4389778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University