View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_high_71 (Length: 222)
Name: NF4125_high_71
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_high_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 47254591 - 47254802
Alignment:
| Q |
1 |
acagcatcagatttctttggcctaagattcttctgagtttggggttttggagaaacattgagatttggtaaattgggaagatcacccaaaacaacccttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47254591 |
acagcatcagatttctttggcctaagtttcttctgagtttggggtttgggagaaacattgagatttggtaaattgggaagatcacccaaaacaacccttt |
47254690 |
T |
 |
| Q |
101 |
gtttcttattgttaagaacaattggttcagcgttagccctcttctttgaagcacgagtctccatctcagctcaggttgaaggagagataagggtttgtga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47254691 |
gtttcttattgttaagaacaattggttcagcgttagccctcttctttgaagcaggagtctccatctcagctcagattgaaggagagataagggtttgtga |
47254790 |
T |
 |
| Q |
201 |
actatgatgatg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47254791 |
actatgatgatg |
47254802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University