View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4125_high_74 (Length: 221)

Name: NF4125_high_74
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4125_high_74
NF4125_high_74
[»] chr1 (1 HSPs)
chr1 (18-209)||(43864138-43864329)


Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 43864138 - 43864329
Alignment:
18 cgccaccgtgagtcggcatgggaccatgcgagtgtgtcgttgacgttgggttgagcagcaactgattcagggatagggcggttggcgaaggattggtcgn 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
43864138 cgccaccgtgagtcggcatgggaccatgcgagtgtgtcgttgacgttgggttgagcagcaactgattcagggatagggcggttggcgaaggattggtcgt 43864237  T
118 nnnnnnggaggatttcttgggcggttgtcggggaggaagcaacggtgacggtgacggagccgaagcggagggacatgatggggccacaggtt 209  Q
          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
43864238 ttttttggaggatttcttgggcggttttcggggaggaagcaacggtgacggtgacggagccgaagcggagggacatgatggggccataggtt 43864329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University