View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_low_2 (Length: 887)
Name: NF4125_low_2
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 6e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 180 - 236
Target Start/End: Original strand, 27778745 - 27778801
Alignment:
| Q |
180 |
aatcatagaagtttgacaatattttttacatccatgtggaaaagtttcaattatatt |
236 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27778745 |
aatcataaaagtttgacaatattttttacatccatgtggaaaagtttcaattatatt |
27778801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 14 - 67
Target Start/End: Original strand, 27778676 - 27778729
Alignment:
| Q |
14 |
acttttccctttttgtgtcatggaatatttctgcatcttcttaagcgtcggttc |
67 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27778676 |
acttttccctttttgtgtcatggaacatttctgcatcttcttaagcgtcggttc |
27778729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 229 - 269
Target Start/End: Original strand, 20742683 - 20742723
Alignment:
| Q |
229 |
attatattgtcaaactaacaagtcttgcaaacatgtgaaat |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20742683 |
attatattgtcaaactaacaagtcttgcaaacttgtgaaat |
20742723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 228 - 268
Target Start/End: Original strand, 5361683 - 5361723
Alignment:
| Q |
228 |
aattatattgtcaaactaacaagtcttgcaaacatgtgaaa |
268 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5361683 |
aattatattgtcaaattaacaagtcttgcaaacatgtgaaa |
5361723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University