View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_low_34 (Length: 422)
Name: NF4125_low_34
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 306 - 412
Target Start/End: Complemental strand, 17263152 - 17263046
Alignment:
| Q |
306 |
tggacaaggaaataaataaaataaagtgcacatgaacatgcttcaaattgtgttttttgctgcaggggagatgaaacggaggtgtacttgtttttacatt |
405 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17263152 |
tggaaaaggaaataaataaaacaaagtgcacatgaacatgcttcaaattgtgttttttgctgcaggggagatgaaacggaggtgcacttgtttttacatt |
17263053 |
T |
 |
| Q |
406 |
gtgatga |
412 |
Q |
| |
|
||||||| |
|
|
| T |
17263052 |
gtgatga |
17263046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 17263203 - 17263146
Alignment:
| Q |
18 |
ggcacaaagatagtgaagcaacaggtgatgactttgaggtttgcaagttcatggaaaa |
75 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17263203 |
ggcacaaagatagtggagcaacaggtgatgactttgaggtttgcaagttcatggaaaa |
17263146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 43 - 161
Target Start/End: Complemental strand, 41661342 - 41661224
Alignment:
| Q |
43 |
tgatgactttgaggtttgcaagttcatggaaaatacggaaggcgaagactactatgatatttcgaaatcaagatgcagaaattgagaggatagtgtaaaa |
142 |
Q |
| |
|
|||||| |||| | ||||||||| |||||| |||| | ||||| | | || | |||| ||| |||||||||| || || |||||||| | |||||||| |
|
|
| T |
41661342 |
tgatgaatttgtgatttgcaagtgcatggacaatatgcaaggcaagaaataatgtgatttttagaaatcaagaggcggacgttgagaggcttgtgtaaaa |
41661243 |
T |
 |
| Q |
143 |
ggtaaatctgatggtgtgg |
161 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
41661242 |
ggtaaagctgatggtgtgg |
41661224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University