View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_low_48 (Length: 363)
Name: NF4125_low_48
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 121 - 355
Target Start/End: Original strand, 4953743 - 4953977
Alignment:
| Q |
121 |
caatttcattcttaaactctcttaannnnnnnatctgtaattggataaactcgtttgattatgacattataatcaataataccattatattggagacaac |
220 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4953743 |
caatttcattcttaaactctcttaatttttttatctgtaattggataaactcgtttgattatgacattataatcaataataccattatattggagacaac |
4953842 |
T |
|
| Q |
221 |
ctttgtacactatacctaggtttccacttccaattattcgatttttatcaaagttgttggttgattttttaatactggctagagaaaattgatgacataa |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4953843 |
ctttgtacactatacctaggtttccacttccaattattcgatttttatcaaagttgttggttgattttttaatactggctagagaaaattgatgacataa |
4953942 |
T |
|
| Q |
321 |
ctcttctattactattggattgtgcttcctatgct |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4953943 |
ctcttctattactattggattgtgcttcctatgct |
4953977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 4953679 - 4953746
Alignment:
| Q |
1 |
aaagatgattatagagagaaccattggaattataatcatacacaataatcttctcatctttatggtcacaat |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4953679 |
aaagatgattatagagagaaccattggaattataatcat----aataatcttctcatctttatggtcacaat |
4953746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University