View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_low_55 (Length: 336)
Name: NF4125_low_55
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_low_55 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 13 - 164
Target Start/End: Complemental strand, 47254614 - 47254463
Alignment:
| Q |
13 |
taggccaaagaaatctgatgctgtccgtttggtttatggtttcaattttgataaaccagatttcagcaaaatcaatgcaaaatctgattatgaagagatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47254614 |
taggccaaagaaatctgatgctgtccgtttggtttatggtttcaattttgataaaccagatttcagcaaaatcaatgcaaaatctgattatgaagagatt |
47254515 |
T |
|
| Q |
113 |
tttgagccttatgcatctgatatctccaactatcttcgcacaatggaggtaa |
164 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47254514 |
tttgagtcttatgcatctgatatctccaactatcttcgcacaatggaggtaa |
47254463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 216 - 321
Target Start/End: Complemental strand, 47254412 - 47254307
Alignment:
| Q |
216 |
aattattggtttgattgtttctcaggttcagaaaaagagaagaccaatgattggttatattgagaaagttcaaagaggtgtcactgctaatatgagaggg |
315 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47254412 |
aatttttggtttgattgtttctcaggttcagaaaaagagaagaccaatgattggttatattgagaaagttcaaagaggtgttactgctaatatgagaggg |
47254313 |
T |
|
| Q |
316 |
atactg |
321 |
Q |
| |
|
|||||| |
|
|
| T |
47254312 |
atactg |
47254307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 245 - 293
Target Start/End: Complemental strand, 47243126 - 47243078
Alignment:
| Q |
245 |
agaaaaagagaagaccaatgattggttatattgagaaagttcaaagagg |
293 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||| ||||||||||| |
|
|
| T |
47243126 |
agaaaaagagaagaccaatgtttggttatatggagaatgttcaaagagg |
47243078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 226 - 293
Target Start/End: Complemental strand, 47249974 - 47249907
Alignment:
| Q |
226 |
ttgattgtttctcaggttcagaaaaagagaagaccaatgattggttatattgagaaagttcaaagagg |
293 |
Q |
| |
|
|||| ||||| |||| | ||||||||||||||||||||| |||||||| ||||||| ||||| ||||| |
|
|
| T |
47249974 |
ttgaatgtttatcagatgcagaaaaagagaagaccaatggttggttatcttgagaatgttcagagagg |
47249907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 164
Target Start/End: Complemental strand, 47250107 - 47250060
Alignment:
| Q |
117 |
agccttatgcatctgatatctccaactatcttcgcacaatggaggtaa |
164 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
47250107 |
agccttatgtatctgatatctctgattatcttcgcacaatggaggtaa |
47250060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University