View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_low_56 (Length: 334)
Name: NF4125_low_56
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 324
Target Start/End: Complemental strand, 38284937 - 38284636
Alignment:
| Q |
23 |
agtatgttggtggaaggtggatgaaggaccaaaatggataaccttcttgtactgatgaagccacggcttaaccaccacaacagagttaaacattctttga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38284937 |
agtatgttggtggaaggtggatgaaggaccaaaatggataaccttcttgtactgatgaagccacggcttaaccaccacaacagagttaaacattctttga |
38284838 |
T |
 |
| Q |
123 |
acaccattatgatcaacggctgagatgttgagatagtatttcatcccagacaccacttgctgctcagcctccaccacttccacgaacttcaacccctctc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38284837 |
acaccattatgatcaacggctgagatgttgagatagtatttcatcccagacaccacttgctgctcagcctccaccacttccacgaacttcaacccctctc |
38284738 |
T |
 |
| Q |
223 |
caccgccgccgttgttcaaaccttgtttgtagttgtactccttcaccgcaaacttccctagctcttgcacctccttgtttgtccccacgtcactgatctc |
322 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38284737 |
cgccgccgccgttgttcaaaccttgtttgtagttgtactccttcaccgcaaacttccctagctcttgcacctccttgtttgtccccacgtcactgatctc |
38284638 |
T |
 |
| Q |
323 |
tg |
324 |
Q |
| |
|
|| |
|
|
| T |
38284637 |
tg |
38284636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University