View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_low_67 (Length: 280)
Name: NF4125_low_67
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_low_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 4953631 - 4953391
Alignment:
| Q |
11 |
caaaggctaaaaatttgcattggagcagcatgtggagtacactatcttcacacaggaacaaaatgtaccatttttcattgtgacattcaacctcataaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4953631 |
caaaggctaaaaatttgcattggagcagcatgtggagtacactatcttcacacaggaacaaaacgtaccatttttcattgtgacattcaacctcataaaa |
4953532 |
T |
|
| Q |
111 |
ttttataggatagtaacatggtgcctaaactctcagatttttggacttcattgcaaggacctttgtttactgattcaatgccgaaaccaaagtccatatt |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4953531 |
ttttattggatagtaacatggtgcctaaactctcagatttttggacttcattgcaaggacctttgtttactgattcaatgccgaaaccaaagtccatatt |
4953432 |
T |
|
| Q |
211 |
aagtgataacattataggtatgtacccttttctctatcatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4953431 |
aagtgataacattataggtatgtacccttttctctaccatt |
4953391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University