View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_low_70 (Length: 260)
Name: NF4125_low_70
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_low_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 20 - 233
Target Start/End: Original strand, 53004625 - 53004838
Alignment:
| Q |
20 |
taattaaggttaaggacacatcacatgtgaaata-acatattttatattttccctcgttnnnnnnnntacatattttccactcaaaagttatattggggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | | ||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53004625 |
taattaaggttaaggacacatcacatgtgaaatatatagattatatattttccctcgttaaaaaaaatacatattttccactcaaaagttatattggggt |
53004724 |
T |
|
| Q |
119 |
gatgcaagagggaagattgttgattatgttggggatttgaagcttgatgctttgattatgggtagcagaggtttgggtgccatacaaaggtactacttac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
53004725 |
gatgcaagagggaagattgttgattatgttggggatttgaagcttgatgctttgattatgggtagcagaggtttgggtgtcatacaaaggtactac-tac |
53004823 |
T |
|
| Q |
219 |
cttggtttgttttcc |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
53004824 |
cttggtttgttttcc |
53004838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 108 - 233
Target Start/End: Original strand, 13604731 - 13604855
Alignment:
| Q |
108 |
tatattggggtgatgcaagagggaagattgttgattatgttggggatttgaagcttgatgctttgattatgggtagcagaggtttgggtgccatacaaag |
207 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
13604731 |
tatattggggtgatgcaagagagaagattgttgattatgttggagatttgaagcttgatgctttggttatgggtaccagaggtttgggtgccatacaaag |
13604830 |
T |
|
| Q |
208 |
gtactacttaccttggtttgttttcc |
233 |
Q |
| |
|
||||||| ||| |||||||||||||| |
|
|
| T |
13604831 |
gtactac-tacgttggtttgttttcc |
13604855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 108 - 216
Target Start/End: Complemental strand, 24269707 - 24269599
Alignment:
| Q |
108 |
tatattggggtgatgcaagagggaagattgttgattatgttggggatttgaagcttgatgctttgattatgggtagcagaggtttgggtgccatacaaag |
207 |
Q |
| |
|
|||| ||||| |||||||||| ||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
24269707 |
tatactggggagatgcaagagagaaaattgttgattctgttggggatttgaagcttgatgctttggttatgggtagcagaggtttgggtgctatacaaag |
24269608 |
T |
|
| Q |
208 |
gtactactt |
216 |
Q |
| |
|
||||||||| |
|
|
| T |
24269607 |
gtactactt |
24269599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University