View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_low_71 (Length: 257)
Name: NF4125_low_71
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_low_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 31056525 - 31056300
Alignment:
| Q |
18 |
ggcaatctggttcatgaaaaattcacccaatttattctcaactttggatatcgcacctttctttgaggagtaggaggtggaggtnnnnnnnnnnnnnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31056525 |
ggcaatctggttcatgaaaaattcacccaatttattctcaactttggatatcgcacctttctttgatgagtaggaggtggaggtagaagaagaagaagaa |
31056426 |
T |
 |
| Q |
118 |
n---ctgcggctgatgttgatgccatggttctagaacccgacataacttctgcttcaagccacatgtaagaaagaacctgacaaataccttcctctactg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31056425 |
gaagctgcggctgatgttgatgccatggttctagaacccgacataacttctgcttcaagccacatgtaagaaagaacctgacaaataccttcctctactg |
31056326 |
T |
 |
| Q |
215 |
caggatcaaggttgcggtaacctgat |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31056325 |
caggatcaaggttgcggtaacctgat |
31056300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 156 - 219
Target Start/End: Original strand, 34742321 - 34742384
Alignment:
| Q |
156 |
cataacttctgcttcaagccacatgtaagaaagaacctgacaaataccttcctctactgcagga |
219 |
Q |
| |
|
||||||||||| ||||||||||| || || ||||||||||| || |||||||||||| ||||| |
|
|
| T |
34742321 |
cataacttctgactcaagccacatatatgacagaacctgacatatgccttcctctacttcagga |
34742384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University