View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_low_85 (Length: 221)
Name: NF4125_low_85
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_low_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 43864138 - 43864329
Alignment:
| Q |
18 |
cgccaccgtgagtcggcatgggaccatgcgagtgtgtcgttgacgttgggttgagcagcaactgattcagggatagggcggttggcgaaggattggtcgn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43864138 |
cgccaccgtgagtcggcatgggaccatgcgagtgtgtcgttgacgttgggttgagcagcaactgattcagggatagggcggttggcgaaggattggtcgt |
43864237 |
T |
 |
| Q |
118 |
nnnnnnggaggatttcttgggcggttgtcggggaggaagcaacggtgacggtgacggagccgaagcggagggacatgatggggccacaggtt |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43864238 |
ttttttggaggatttcttgggcggttttcggggaggaagcaacggtgacggtgacggagccgaagcggagggacatgatggggccataggtt |
43864329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University