View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4125_low_86 (Length: 219)
Name: NF4125_low_86
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4125_low_86 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 20 - 206
Target Start/End: Complemental strand, 2348531 - 2348345
Alignment:
| Q |
20 |
gttgaagaaattgatgaatggtaattcagataaaactaatcacaaaaacagtaatgataaagtattgtggccaattggtgtgttgttaggatccaaagat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2348531 |
gttgaagaaattgatgaatggtaattcagataaaactaatcacaaaaacagtaatgataaagtattgtggccaattggtgttttgttaggatccaaagat |
2348432 |
T |
|
| Q |
120 |
taccaagtgaggagaagattgggaagggggaaggaatttaaggaaattcaatggttaggacaaagttttgctctgaggcatattctt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2348431 |
taccaagtgaggagaagattgggaagggggaaggaatttaaggaaattcaatggttaggacaaagttttgctctgaggcattttctt |
2348345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University