View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4125_low_89 (Length: 208)

Name: NF4125_low_89
Description: NF4125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4125_low_89
NF4125_low_89
[»] chr4 (1 HSPs)
chr4 (13-192)||(35673907-35674086)


Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 13 - 192
Target Start/End: Complemental strand, 35674086 - 35673907
Alignment:
13 gaataaacatacagtaaaatgagcttatgctataagctagcgaattgcccttgccaaacataccctaaatttagtatctattatannnnnnnnggttaca 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||    
35674086 gaataaacatacagtaaaatgagcttatgctataagctagcgaattgcccttgccaaacataccctaaatttagtatctattatattttttttggttaca 35673987  T
113 tctggtatctattatatgctacagggcaatattacattacattaaccgaaaataaaatttaaatgaatgatagtgactta 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||    
35673986 tctggtatctattatatgctacagggcaatattacattacattaaccgagaataaaatttaaatgaatgatagcgactta 35673907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University