View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4126_high_17 (Length: 255)
Name: NF4126_high_17
Description: NF4126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4126_high_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 22790271 - 22790173
Alignment:
| Q |
1 |
tgtacaaagaaatcctcgaaataacgtctgaaagtgtaatttgaattaatcatttactctttttagttccaaactgaattctatgtttcttagatgata |
99 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22790271 |
tgtacaaagaaatccttgaaataacgtctgaaagtgtaatttgaattaatcatttactctttttagttccaaactgaattctatgtttcttagatgata |
22790173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 170
Target Start/End: Complemental strand, 22790062 - 22790025
Alignment:
| Q |
133 |
aaataagttgaagggtcagagaaatatatggatttgtg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22790062 |
aaataagttgaagggtcagagaaataaatggatttgtg |
22790025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University