View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4126_high_23 (Length: 239)
Name: NF4126_high_23
Description: NF4126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4126_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 221
Target Start/End: Complemental strand, 41632752 - 41632543
Alignment:
| Q |
12 |
caaaggttgtgaatagacgacaaaattaaatggacaaatttctaactaattttgtcgtttatttatgttatccaatagccacattacaccctccaatcca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41632752 |
caaaggttgtgaatagacgacaaaattaaatggacaaatttctaactaattttgtcgttcatttatgttatccaatagccacattacaccctccaatcca |
41632653 |
T |
 |
| Q |
112 |
atacggcacccctggatagaaagcaattcgatggggacgaatctggcttttgatttgtcctattttccaaatttattttgttcaatgaatggtttatgtt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41632652 |
atacggcacccctggatagaaagcaattcgatggggacgaagatggcttttgatttgtcctattttccaaatttattttgttcaatgaatggtttatgtc |
41632553 |
T |
 |
| Q |
212 |
aagggttaaa |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
41632552 |
aagggttaaa |
41632543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 138 - 221
Target Start/End: Original strand, 33057008 - 33057090
Alignment:
| Q |
138 |
ttcgatggggacgaatctggcttttgatttgtcctattttccaaatttattttgttcaatgaatggtttatgttaagggttaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
33057008 |
ttcgatggggacgaatctggcttttgatttgtcctattttccaaatttattttgttcaatgaatgg-ttatgtcaagggttaaa |
33057090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University