View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4126_high_24 (Length: 232)

Name: NF4126_high_24
Description: NF4126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4126_high_24
NF4126_high_24
[»] chr3 (1 HSPs)
chr3 (34-232)||(38465316-38465519)


Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 34 - 232
Target Start/End: Complemental strand, 38465519 - 38465316
Alignment:
34 taatattgaatttttgtgcaaaaatgaataccagtttttctttacgtagacaaaaaa----gtgaaatttcccaacaaaacacatagaag-ttc-cccat 127  Q
    ||||||||| || ||||| ||||||||||||||||||| |||||||||| |||||||    |||||| |||||||||||||||| ||||  ||| |||||    
38465519 taatattgatttcttgtggaaaaatgaataccagtttt-ctttacgtaggcaaaaaaaaaagtgaaacttcccaacaaaacacaaagaaacttctcccat 38465421  T
128 aaagtgtcaaattttgtctccatgatgaaactaattaatgatgtaaattgttcacttttgcgactgaattcgggtaagtacgatgaatgaggaagggtag 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38465420 aaagtgtcaaattttgtctccatgatgaaactaattaatgatgtaaattgttcacttttgcgactgaattcgggtaagtacgatgaatgaggaagggtag 38465321  T
228 ctgca 232  Q
    |||||    
38465320 ctgca 38465316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University