View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4126_low_13 (Length: 348)
Name: NF4126_low_13
Description: NF4126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4126_low_13 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 132 - 348
Target Start/End: Original strand, 53499746 - 53499961
Alignment:
| Q |
132 |
ccatgtaaaatatcatatgtagtcgtagctagatcacctttgtaactaaattaaatatatatgaatggtatttataacagttatcccataattctcatgt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53499746 |
ccatgtaaaatatcatatgtagtcgtagctagatcacctttgtaactaaat-atatatatatgaatggtatgtataacagttatcccataattctcatgt |
53499844 |
T |
 |
| Q |
232 |
caattttcacattattctctcatattgcaacaattttgactattactattacatgcatgtaacgttccaaaagaatgaatgaaattgcgtggggagacca |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53499845 |
caattttcacattattctctcatattgcaacaattttgactattactattacatgcatgtaacgttccaaaagaaagaatgaaattgcgtggggagacca |
53499944 |
T |
 |
| Q |
332 |
cacttccatttctctgt |
348 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
53499945 |
cccttccatttctctgt |
53499961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 58
Target Start/End: Original strand, 53499630 - 53499670
Alignment:
| Q |
18 |
tcatatactataggactctcataactcattgcctcacgatc |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53499630 |
tcatatactataggactctcataactcattgcctcacgatc |
53499670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University