View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4126_low_21 (Length: 250)
Name: NF4126_low_21
Description: NF4126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4126_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 79 - 235
Target Start/End: Original strand, 22408149 - 22408305
Alignment:
| Q |
79 |
tatggggggtgaccggaaagaggaggaagaataagattatagaaggggagatgtgaagctgtgagagaggtagataagagaaaaagccaccaaatttata |
178 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22408149 |
tatggggggtgaccggaaagagaaggaagaataagattatagaaggggagaggtgaagttgtgagagaggtagataagagaaaaagccaccaaatttata |
22408248 |
T |
 |
| Q |
179 |
tactctataaatttctaatgcatctagcatgtgcatacattccggttaatagaactg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22408249 |
tactctataaatttctaatgcatctagcatgtgcatacattccggttaatagaactg |
22408305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University