View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4126_low_28 (Length: 236)
Name: NF4126_low_28
Description: NF4126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4126_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 26 - 185
Target Start/End: Complemental strand, 1158937 - 1158777
Alignment:
| Q |
26 |
tcatgagattaatgaaaatcgacatgcattccttttagtgtcatcgtattgtcgatcaagctaattgtgatatgttaaaagattttaggcattagcag-a |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| | |
|
|
| T |
1158937 |
tcatgagattaatgaaaatcgacatgcattccttttagtgtcatcgtgttgtcgatcaagctaattgtgacatgttaaaagattttaggcattagcagaa |
1158838 |
T |
|
| Q |
125 |
atcaaataggtttcactcttgattgaagaacatatacaattaacattcgtgtttttaatca |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1158837 |
atcaaataggtttcactcttgattgaagaacatatacaattaacattcgtgtttttaatca |
1158777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University