View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4126_low_29 (Length: 232)
Name: NF4126_low_29
Description: NF4126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4126_low_29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 34 - 232
Target Start/End: Complemental strand, 38465519 - 38465316
Alignment:
| Q |
34 |
taatattgaatttttgtgcaaaaatgaataccagtttttctttacgtagacaaaaaa----gtgaaatttcccaacaaaacacatagaag-ttc-cccat |
127 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||||||| |||||||||| ||||||| |||||| |||||||||||||||| |||| ||| ||||| |
|
|
| T |
38465519 |
taatattgatttcttgtggaaaaatgaataccagtttt-ctttacgtaggcaaaaaaaaaagtgaaacttcccaacaaaacacaaagaaacttctcccat |
38465421 |
T |
 |
| Q |
128 |
aaagtgtcaaattttgtctccatgatgaaactaattaatgatgtaaattgttcacttttgcgactgaattcgggtaagtacgatgaatgaggaagggtag |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38465420 |
aaagtgtcaaattttgtctccatgatgaaactaattaatgatgtaaattgttcacttttgcgactgaattcgggtaagtacgatgaatgaggaagggtag |
38465321 |
T |
 |
| Q |
228 |
ctgca |
232 |
Q |
| |
|
||||| |
|
|
| T |
38465320 |
ctgca |
38465316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University