View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4126_low_9 (Length: 412)
Name: NF4126_low_9
Description: NF4126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4126_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 396
Target Start/End: Original strand, 48648704 - 48649094
Alignment:
| Q |
1 |
atgaatcttgcagcacgagtggatgaatggatgggttcttaatttgttttctcttgagaatgagaatcaaacttgtagttcgagtgttggattaannnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48648704 |
atgaatcttgcagcacgagtggatgaatggatgggttcttaatttgttttctcttgagaatgagaatcaaacttgtagttcgagtgttggattaattttt |
48648803 |
T |
|
| Q |
101 |
nnnnnnnnnnnngacttattagtagttgagttcgggcatgcatgctctctgtcccttttttattttattcttccgtaccgatcgatataatacggtgcat |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48648804 |
ctttctctttttgacttattagtagttcagttcgggcatgcatgctctctgtcccttttttattttattcttccgtaccgatcgatataatacggtgcat |
48648903 |
T |
|
| Q |
201 |
ctgcatatcaaacatcataaagtttcctcttagtgggccaattaactgctgggtgatttgtaatagccaatggcatcttctttttgactaaatacaacgg |
300 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48648904 |
ctgcat--caaacatcataaagtttcctcttagtgggccaattaactgctgggtgatttgtaatggccaatggcatcttctttttgactaaatacaacgg |
48649001 |
T |
|
| Q |
301 |
cctcttttaagctttttctagagtatatttcaagaatattagtgtgtaaataagtcacatagacaaggttgcaaatagaaccaaacttagtttacg |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48649002 |
actcttttaagctttttctagagtatatttcaagaa---tagtgtgtaaataagtcacatagacaaggttgcaaatagaaccaaacttagtttacg |
48649094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University