View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4127_low_15 (Length: 316)
Name: NF4127_low_15
Description: NF4127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4127_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 6e-34; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 111 - 188
Target Start/End: Original strand, 37259064 - 37259141
Alignment:
| Q |
111 |
gttttgttagtgtgattttcatgtcctatatcttttatgttatggcatcaaaaaatgaacattgtgttatatttgtgc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37259064 |
gttttgttagtgtgattttcatgtcctatatcttttgtgttatggcatcaaaaaatgaacattgtgttatatttgtgc |
37259141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 250 - 299
Target Start/End: Original strand, 37259259 - 37259304
Alignment:
| Q |
250 |
cgtagtttataatgtgaaaatatatatggcataagatggaggaacgcgtg |
299 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37259259 |
cgtagtttataatgtgaaaatat----ggcataagatggaggaacgcgtg |
37259304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 216
Target Start/End: Original strand, 37259185 - 37259214
Alignment:
| Q |
187 |
gccatgaaaattctggagtgagatatgatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37259185 |
gccatgaaaattctggagtgagatatgatt |
37259214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University