View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4127_low_27 (Length: 222)
Name: NF4127_low_27
Description: NF4127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4127_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 33840465 - 33840643
Alignment:
| Q |
20 |
ctcacacccatagcataaaaaatgtgtgtcactcatccatcttatctttcaaacgtgtcgttcatctaatcgaacatagcactgtatagtacaatcaaat |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33840465 |
ctcacacgcatagcataaaaaatgtgtgtcactcatccatcttatctttcaaacgtgtcgttcatctaatcgaacacagcactgtatagtacaatcaaat |
33840564 |
T |
 |
| Q |
120 |
tcaactctcaacaaattttctccaccgcgttataaatttgcacactatatgtcatgcaaaagcatccctcataatacat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33840565 |
tcaactctcaacaaattttctccaccgcgttataaatttgcaaactatatgtcatgcaaaagcatccctcataatacat |
33840643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University