View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4128_high_11 (Length: 290)
Name: NF4128_high_11
Description: NF4128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4128_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 4e-41; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 195 - 280
Target Start/End: Complemental strand, 12157621 - 12157536
Alignment:
| Q |
195 |
agtctatatttatacacaaagaaccaagttgataggaaatcaaggggatattggtctttgattgggtgctactagtcttgcctttg |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12157621 |
agtctatatttatacacaaagaaccaagttgataggaaatcaaggggatattggtctttgattgggtgctactagtcttgcctttg |
12157536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 80 - 138
Target Start/End: Complemental strand, 12157736 - 12157678
Alignment:
| Q |
80 |
tagggaatgagttttgggtatgttcccacaacaacgtaaggtatgatgattcatgctaa |
138 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12157736 |
taggaaatgagttttgggtatgttcccacaacaacgtaaggtatgatgattcatgctaa |
12157678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 12157798 - 12157761
Alignment:
| Q |
18 |
gttgcaaggtcgaaagctgagtttgtgaaactgaagag |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12157798 |
gttgcaaggtcgaaagctgagtttgtgaaactgaagag |
12157761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University