View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4128_high_11 (Length: 290)

Name: NF4128_high_11
Description: NF4128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4128_high_11
NF4128_high_11
[»] chr5 (3 HSPs)
chr5 (195-280)||(12157536-12157621)
chr5 (80-138)||(12157678-12157736)
chr5 (18-55)||(12157761-12157798)


Alignment Details
Target: chr5 (Bit Score: 86; Significance: 4e-41; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 195 - 280
Target Start/End: Complemental strand, 12157621 - 12157536
Alignment:
195 agtctatatttatacacaaagaaccaagttgataggaaatcaaggggatattggtctttgattgggtgctactagtcttgcctttg 280  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12157621 agtctatatttatacacaaagaaccaagttgataggaaatcaaggggatattggtctttgattgggtgctactagtcttgcctttg 12157536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 80 - 138
Target Start/End: Complemental strand, 12157736 - 12157678
Alignment:
80 tagggaatgagttttgggtatgttcccacaacaacgtaaggtatgatgattcatgctaa 138  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12157736 taggaaatgagttttgggtatgttcccacaacaacgtaaggtatgatgattcatgctaa 12157678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 12157798 - 12157761
Alignment:
18 gttgcaaggtcgaaagctgagtttgtgaaactgaagag 55  Q
    ||||||||||||||||||||||||||||||||||||||    
12157798 gttgcaaggtcgaaagctgagtttgtgaaactgaagag 12157761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University