View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4129_high_5 (Length: 285)
Name: NF4129_high_5
Description: NF4129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4129_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 141 - 269
Target Start/End: Complemental strand, 14183020 - 14182892
Alignment:
| Q |
141 |
ggtcctcgccctaacccttcttccgtcgctgcttctcgcgatgttgatgttcatgtctaccaggctttgttgagggtgcaggatatgcatgatgagtgtg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
14183020 |
ggtcctcgccctaacccttcttccgtcgctgcttctcgcgacgttgatgttcacgtctaccaggctttgttgagggtggaggatatgcatgatcagtgtg |
14182921 |
T |
|
| Q |
241 |
tgaagcagttgagggttgctgaggagaag |
269 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14182920 |
tgaagcagttgagggttgctgaggagaag |
14182892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 22 - 73
Target Start/End: Complemental strand, 14183139 - 14183088
Alignment:
| Q |
22 |
tccatcaaaacctcttaaccaacttccctcatttaaccaactccaaactcat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14183139 |
tccatcaaaacctcttaaccaacttccctcatttaaccaactccaaactcat |
14183088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University