View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4129_low_7 (Length: 257)
Name: NF4129_low_7
Description: NF4129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4129_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 239
Target Start/End: Complemental strand, 11195007 - 11194780
Alignment:
| Q |
11 |
cacagaattgcaatatgttactttctctaaccatggctacaagacaagggcaatcacacactttgcacaatgcacataaagaaaagaagataaaagctga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11195007 |
cacagaattgcaatatgttactttctctaaccatggctacaagacaagggcaatcacacacatt-cacaatgcacatatagaaaagaagataaaagctga |
11194909 |
T |
 |
| Q |
111 |
aaagttccattgaaaagactagaccatgtttggataaacaataaaatcaatcacttatagcataattgcaatattgtttccataaacagtctcacaaaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11194908 |
aaagttccattgaaaagactagaccatgtttggataaacaataaaatcaatcacttatagcataattgcaatattgtttccataaacagtctcacaaaat |
11194809 |
T |
 |
| Q |
211 |
gcttatacaagtacatagtagctcagata |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11194808 |
gcttatacaagtacatagtagctcagata |
11194780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University