View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4129_low_8 (Length: 242)
Name: NF4129_low_8
Description: NF4129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4129_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 5325860 - 5325634
Alignment:
| Q |
1 |
caattttaggatgtaaaagttggaattaacatgtcgggtcggcctattaaactcaaaattaacctgtcgtttaacttgttgaaaaaatcggacggtggca |
100 |
Q |
| |
|
||||| ||||||| |||||||||||||||| || | ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5325860 |
caattataggatggaaaagttggaattaacctgacaggtcggcctattaaactcaaaattaacctgtcgttgaacttgttgaaaaaatcggacggtggca |
5325761 |
T |
 |
| Q |
101 |
ggacgatttgacataagtagataaattaacctttgatttttgagtctttgaataacaaatttgatggttttacattttttcctttctattcatgggtagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||| | || |||| || ||||| ||||||||| |
|
|
| T |
5325760 |
ggacgatttgacataagtagataaattaacctttgaattttcagtctttgaataataaatttgatggtttcatatatttt--ttcctattgatgggtagc |
5325663 |
T |
 |
| Q |
201 |
tattgagctaagcaaaagtgttcttgatg |
229 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
5325662 |
tattgagctaagcaaaagtgttattgatg |
5325634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University