View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4130_low_5 (Length: 250)
Name: NF4130_low_5
Description: NF4130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4130_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 10617510 - 10617756
Alignment:
| Q |
1 |
agctaacacaaaggaataaaatagaagttggatagatcaacatcaaatgcttgatatccaagatacaatggacctcataatgaaagtaactctgtcgata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||| || |
|
|
| T |
10617510 |
agctaacacaaaggaataaaatagaagttgggtagatcaacatcaaatgcttgatatccaaaatacaatggacctaataatgaaagtaactctctcggta |
10617609 |
T |
 |
| Q |
101 |
aattttctctctcttggatnnnnnnntgaataactaaaaacaaggctga-------tacatatagatttcataaaagtggattttcgcttagcgaattat |
193 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| || ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10617610 |
aattttctctctcttggataaaaaaatgaataactaaaaataaggcagagaatctttacatatagatttcataaaagtggactttcgcttagcgaattat |
10617709 |
T |
 |
| Q |
194 |
ggctcttccaatgcaatttttcatttgtcaaggtagtttttcctttg |
240 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
10617710 |
ggctcctccaatacaatttttcatttgtcaaggtagtttttcttttg |
10617756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University