View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4131_high_10 (Length: 229)
Name: NF4131_high_10
Description: NF4131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4131_high_10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 116 - 229
Target Start/End: Original strand, 31647452 - 31647565
Alignment:
| Q |
116 |
gtttgggtggaggatttccaagggcggtcagttttgggatgatggtagtttcaaggctgaaacatcttggctatgattcactgagtggtggttagcttat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
31647452 |
gtttgggtggaggatttccaagggcggtcagttttaggatgatggtagtttcaaggctgaaacatcttggatatgattcaatgagtggtggttagcttat |
31647551 |
T |
|
| Q |
216 |
gaaatggtattgtt |
229 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
31647552 |
gaaatggaattgtt |
31647565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University