View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4131_low_13 (Length: 235)
Name: NF4131_low_13
Description: NF4131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4131_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 10030796 - 10030574
Alignment:
| Q |
1 |
attagggagacatggatctggatataatattaattagattgatannnnnnnnnnnnnngataaataattagattgataatataagtgatttatatgaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10030796 |
attagggagacatggatctggatataatattaattacattgataatttatttttttt-gataaataattagattgataatataagtgatttatatgaaaa |
10030698 |
T |
 |
| Q |
101 |
taatatatttggataggtaaatgttagtggcttcggaagaaaatatgaaannnnnnnacagtgttaaccctatagttcataggagaagcagatt-aagta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| ||| |||||||||||||||||||||| ||||| |
|
|
| T |
10030697 |
taatatatttggataggtaaatgttagtggcttcggaagaaaatatgaaattttttcacaatgttaatcctctagttcataggagaagcagattcaagta |
10030598 |
T |
 |
| Q |
200 |
atccagagttcggccagatgtctg |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10030597 |
atccagagttcggccagatgtctg |
10030574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University