View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4131_low_14 (Length: 229)

Name: NF4131_low_14
Description: NF4131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4131_low_14
NF4131_low_14
[»] chr8 (1 HSPs)
chr8 (116-229)||(31647452-31647565)


Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 116 - 229
Target Start/End: Original strand, 31647452 - 31647565
Alignment:
116 gtttgggtggaggatttccaagggcggtcagttttgggatgatggtagtttcaaggctgaaacatcttggctatgattcactgagtggtggttagcttat 215  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||    
31647452 gtttgggtggaggatttccaagggcggtcagttttaggatgatggtagtttcaaggctgaaacatcttggatatgattcaatgagtggtggttagcttat 31647551  T
216 gaaatggtattgtt 229  Q
    ||||||| ||||||    
31647552 gaaatggaattgtt 31647565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University