View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4131_low_5 (Length: 378)
Name: NF4131_low_5
Description: NF4131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4131_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 13 - 363
Target Start/End: Complemental strand, 456925 - 456575
Alignment:
| Q |
13 |
aatatctctcaatccaacggttattttctcagcatcactggtttcaatagcgtcaacgccgtcggtggactcttcctatgtcgtggcgacgtcgccacca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456925 |
aatatctctcaatccaacggttattttctcggcatcactggtttcaatagcgtcaacgccgtcggtggactcttcctatgtcgtggcgacgtcgccacca |
456826 |
T |
 |
| Q |
113 |
ccgtatgtaaccagtgtctcacaactgcaatcaaagagataagacagcattgtccaaaccaaaccgaagcactcatctggtacgacgagtgcttcgttcg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
456825 |
ccgtatgtaaccagtgtctcacaactgcaatcaaagagataagacagcattgtccaaaccaaaccgaagcactcatctggtacgacgagtgcttggttca |
456726 |
T |
 |
| Q |
213 |
ttacacaaataggtactttgccgtcgacaagattgaccctagagtcaaccttaacgacggaaatattgtctctagcgttgacttgggacgtttcaaccaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456725 |
ttacacaaataggtactttgccgtcgacaagattgaccctagagtcaaccttaacgacggaaatattgtctctagcgttgacttgggacgtttcaaccaa |
456626 |
T |
 |
| Q |
313 |
tctctgcatgggttgttgaatgatttggcaacagaagcctccgggagttct |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456625 |
tctctgcatgggttgttgaatgatttggcaacagaagcctccgggagttct |
456575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University