View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4132_high_2 (Length: 208)

Name: NF4132_high_2
Description: NF4132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4132_high_2
NF4132_high_2
[»] chr4 (2 HSPs)
chr4 (19-112)||(40820176-40820269)
chr4 (155-193)||(40820312-40820350)


Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 40820176 - 40820269
Alignment:
19 aaaactggagtaaacggcaacaaaaatgtttgatttttggaggtaatggcaacgatcaagcctcattcgagcaatagaagtttctatctgtata 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
40820176 aaaactggagtaaacggcaacaaaaatgtttgatttttggaggtaatggcaacgatcaagcctcattcgagcaacagaagtttctatctgtata 40820269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 193
Target Start/End: Original strand, 40820312 - 40820350
Alignment:
155 cctaactcctaagatatagaaacgagttaatgacctatg 193  Q
    |||||||||||||| ||||||||||||||||||||||||    
40820312 cctaactcctaagagatagaaacgagttaatgacctatg 40820350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University