View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4133_high_3 (Length: 239)
Name: NF4133_high_3
Description: NF4133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4133_high_3 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 28967603 - 28967381
Alignment:
| Q |
18 |
agacaccccaacctcaaaaggatgggattacaatccaagtgttggcaacacgagatctctacagaatgtcattctaaagctagccgatcatcatctataa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28967603 |
agacaccccaacctcaaaaggatgggattacaatccaagtgttggcaacacgagatctctacagaatgtcattctaaagctagccaatcatcatctataa |
28967504 |
T |
|
| Q |
118 |
tgatttttagt-aatgactttatatcctttccatcgtctgtgccattaaaatcttccttcaacgatgtccattactatcaattcaaatctttcaagcacc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28967503 |
tgatttttagtaaatgactttatatcctttccatcgtctgtgccattaaaatcttccttcaacgatgtccattactatcaattcaaatctttcaagcacc |
28967404 |
T |
|
| Q |
217 |
tgagcaaaagctttaactcttac |
239 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
28967403 |
tgggcaaaagctttaactcttac |
28967381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University