View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4133_high_8 (Length: 221)

Name: NF4133_high_8
Description: NF4133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4133_high_8
NF4133_high_8
[»] chr8 (1 HSPs)
chr8 (79-211)||(4620402-4620534)


Alignment Details
Target: chr8 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 79 - 211
Target Start/End: Complemental strand, 4620534 - 4620402
Alignment:
79 accctgtacctatgtatcataggttatcattggttttgcnnnnnnngacttgtcagaatgttattcttttgttttgttggtagctagcatactgaaagta 178  Q
    |||||||||||||||||||||||||||||||||||||||       ||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
4620534 accctgtacctatgtatcataggttatcattggttttgctttttttgacttgtcaaaatgttattcttttgttttgttggtagctagcatactgaaagta 4620435  T
179 atttattttactaatgtcctgttgttttctgtg 211  Q
    |||||||||||| ||||||||||||||||||||    
4620434 atttattttacttatgtcctgttgttttctgtg 4620402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University