View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4133_low_5 (Length: 238)
Name: NF4133_low_5
Description: NF4133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4133_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 43 - 230
Target Start/End: Original strand, 34122978 - 34123165
Alignment:
| Q |
43 |
tatttcttgatttcaagctttcggttttcttcatttttatagtctaaattcatttctatatttcattctaatggttcgcacaaccctcttcataatttct |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34122978 |
tatttcttgatttcaagctttcggttttcttcatttttatagtctaaattcatttctatatttcattctaatggttcgcacaaccctcttcagaatttct |
34123077 |
T |
|
| Q |
143 |
aatataccaattttgtcattatacgatatatatacttattgctcttattacttatctttcatgttttttgacaaatcacccttcattt |
230 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34123078 |
aatataccaattttgtgattatacgatatatatacttattgctcttattacttatctttcatgttttttgacaaatcacccttcattt |
34123165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University