View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4133_low_9 (Length: 222)
Name: NF4133_low_9
Description: NF4133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4133_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 9 - 206
Target Start/End: Complemental strand, 45869381 - 45869184
Alignment:
| Q |
9 |
acatcatcagcagcagctgccatttcagcagtagggtatgttcctaaccaaatgcgttttgttttacgtggctcacgtatctctgatacccatttcccac |
108 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45869381 |
acatcataagcagcagctgccatttcagcagtagggtatgttcctaaccaaatgcgttttgttttacgtggctcacgtatctctgatacccatttaccac |
45869282 |
T |
|
| Q |
109 |
tcctacaacgggttccacggtatcttcctgcgactccggtagtcgccggagaagatgaaggagttgttggtgctgatgatacatcaggaagttgtatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
45869281 |
tcctacaacgggttccacggtatcttcctgcgactccggtagtcgccggagaagatgaaggagttgttggtgctgatgatgcatcaggaggttgtatt |
45869184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University